FORMAT DESCRIPTION

We described four different types of files, including
1.ContigCov.txt   :     describes each chromosome with a list of coordinates 
                        to the aligned regions.
2.SNPlist.txt     :     list of the SNPs and INDELs with external 
3.exon_intron.txt :     details of the cDNA-to-genome alignment
4.GeneSNPcon.txt  :     SNPs association to gene structure etc., indicating 
                        functional context.

----------------------------------------------------------------------------
Please email chickvd@genomics.org.cn if you have any problem about format. 
----------------------------------------------------------------------------

-----------------
1. ContigCov.txt
-----------------

Documentation Source:

The file shows a list of coordinates to the aligned regions. We used reads
(or contigs by using phrap) from one of three strains to align to chromosome 
from the RJF genome assembly. 

*** ContigCov.txt format and data structure ***

Example:

Covered Region List
        6906    7483
        7895    8377
        8654    9168

The aligned region means at least one read is aligned to the RJF genome assembly.

Notes:

filename        = the name of the chr. 
6906            = start position of aligned region with chr coordinates.
7483            = end position of aligned region with chr coordinates.


----------------
2. SNPlist.txt
----------------
Documentation source:

SNPs identitied with detailed information list.
This format provides the details of SNP information, including <snpId>, 
<SNP type>, <posChr>, <posReads>, <qualChr>, <qualReads>, <Changes>, 
<flankingSeqContig>, <flankingSeqReads>, <ReadsName>, <strand>, <occurStr>,
<primerL>, <primerR>, <questionM>, <reservePos>. 

*** SNPlist.txt format and data structure  ***


Example:

        snp.0.1001.817.1        S       817     161     97      51     A->C    TGTTAACAATGAGTAACAAAATCAGGCAGGGCTCTAGTAA   TGTTAACAATGAGTAACAACATCAGGCAGGGCTCTAGTAA	rchsxb0_104909.y1.scf F BLS  TCTACTCAGTTTTGGATCATTTC CTAGGAATTGCCTCAGTGAC  398 123 H Y 

           <snpId> <SNP type> <posChr> <posReads> <qualChr> <qualReads> <Changes> <flankingSeqLeft> <flankingSeqRight> <ReadsName> <strand> <occurStr> <primerL> <primerR> <ampliconSize> <distanceL> <questionM> <transposonM> <reservePos>

Notes:


1. filename : the name of the chr where a SNP is identified. 
2. Each columns were seperated by "\t". 
2. The detailed information of each SNP presented in columns.
Column  symbol          Description 
  1	snpId      :	a unique name asigned to each SNP
			snp.10.103.59910.S.1:  10.103 indicates Contig.10.103
					       59910  indicates the base position at Contigs.10.103
					       S indicates type of polymorphism.
					       1 strain name and version number,
						    1: Broiler strain
						    2: Layer strain, 
						    3: Silkie strain,
						    4: Wag_BES_BAC,
  2	SNP type   :	SNP type, S: substitution; I: insertion; D: deletion
  3	posChr     :	position of each SNP with chromosome coordinates
			Note that insertion-deletion positions are given as two numbers.
			for example,
			1-bp insertion            * *
			RJF sequence      TCCAGAATA-CAGATTTTGTACAGGCATACAGCCTG
			Layer sequence    TCCAGAATAGCAGATTTTGTACAGGCATACAGCCTG

			3-bp deletion                          *   *
			RJF sequence      TCCAGAATACAGATTTTGTACAGGCATACAGCCTGG
			Layer sequence    TCCAGAATACAGATTTTGTACA---ATACAGCCTGG
  4	posReads   :	position of each SNP with read coordinates
			for indel, see description in posChr.
  5	qualChr    :	quality value of each SNP in chromosome
  6	qualReads  :	quality value of each SNP in reads
  7	Changes    :	"C->G" changes of the sequences, from the reference(genome) sequence to strain-specific(read) sequence
			if SNP type is insertion or deletion (indels), then we will give the inserted/deleted sequence.
  8	flankingSeqLeft:
			a 20-bp sequence, left of the SNP position on the reference sequence side.
  9	flankingSeqRight:
			a 20-bp sequence, right of the SNP position on the reference sequence side.
  10	ReadsName  :	the name of the reads(or contigs assemblied by using phrap), 
                   	SNP is found by comparison between the reference contigs(RJF) and the reads. 
  11	strand     :	"F" means forword, "R" means reversed. relation between genome and reads.
  12	occurStr   :	"BLS" means this snp was found in B (Brolier), L (Layer) and S (Silkie) strains.
			"BL-" "-" means this position was coverd but do not have snp in S (Silkie) strains.
			"BLX" "X" means this position was not coverd by S (Silkie) strains.
  13	primerL    :	the sequence of left primer
  14	primerR    :	the sequence of right primer
  15	ampliconSize:	the expected amplicon size of primers
  16	distanceL  :	distance from left primer to the snp or indel site
  17	questionM  :	all the SNPs will be indicated with "H"; all dubious indels were indicated with "L", other indels were "H"
  18	transposonM:	"Y" means this position was masked by RepeatMasker; "N" means it was not.
  19	reservePos :	the column reserved for further

--------------------
3. exon_intron.txt
--------------------

Documentation source:
Gene location in a chicken chromosome with map information.

*** exon_intron.txt format and data structure ***

Example:

gnl|UG|Gga#S7086537     chr1    +       166344623       166349403       166344623      166349403       3       166344623,166345115,166346191,  166344782,166345511,166349403,
<GeneName>  <chr> <strand> <txStart>  <txEnd>  <cdsStart>  <cdsEnd>  <exonCount>  <exonStartList>           <exonEndList> <identity>

Notes:

1. the details of location information.
Column  symbol          Description 
  1	GeneName   :    the name of gene
  2	chrNum     :    chromosome number, location in chromosome 
  3	strand     :    + or - for the strand, +: forward; -: reverse
  4	txStart    :    Transcription start position in chromosome coordinate
  5	txEnd      :    Transcription end position in chromosome coordinate
  6	cdsStart   :    Coding region start position in chromosome coordinate. 
  7	cdsEnd     :    Coding region end position in chromosome coordinate.
  8	exonCount  :    Number of exons
  9	exonStartList:  Exon start positions, seperated by comma
  10	exonEndList:    Exon end positions, seperated by comma
  11	identity   :	identity of gene location

-------------------
4. GeneSNPcon.txt
-------------------
Documentation source:
SNPs association to gene structure etc., indicating functional context.

*** GeneSNPcon.txt format and data structure ***

The file was constructed with the following format:

     1. Rows start with one of the following keywords: 
        GN, GP, S5, S3, U5, U3, CS, CN, CF, IR, SS
     2. Fields are delimited by pipe '\t' character
     3. Each "GN" row was given a gene name where the SNPs were located.
     4. Each "GP" row was given the gene's location in genome.
     5. Each "S5" row was given a SNP located in 5' upstream.
     6. Each "S3" row was given a SNP located in 3' upstream.
     7. Each "U5" row was given a SNP located in 5' UTR.
     8. Each "U3" row was given a SNP located in 3' UTR.
     9. Each "CS" row was given a SNP located in coding region,
        where the SNP is a synonymous SNP.
     10.Each "CN" row was given a SNP located in coding region,
        where the SNP is a non-synonymous SNP.
     11.Each "CF" row was given a SNP located in coding region,
        where the SNP caused a frame shift.
     12.Each "IR" row was given a SNP located in intron region,
     13.Each "SS" row was given a SNP located in splice site region.
        splice site region meant the splice site(GT/AG) position.


The lines and fields reported in the flatfile format are:

Keyword	  Description
GN        Gene Name
GP        Gene position at genome
S5        5' upstream
S3        3' downstream
U5        5' UTR
U3        3' UTR
CS        coding - synonymous
CN        coding - non-synonymous
CF        coding - frame shift
IR        intron
SS        splice site

== symbol format example ===
GN    <GeneName>
GP   <chrNum>  <txStart>    <txEnd>    <strand> <identity> <partM>
S5   <snpId> <SNP type> <posGene> <posChr>  <qualChr> <qualReads> <advChanges>	n/a	n/a	n/a	<otherInfo>
S3   <snpId> <SNP type> <posGene> <posChr>  <qualChr> <qualReads> <advChanges>	n/a	n/a	n/a	<otherInfo>
U5   <snpId> <SNP type> <posGene> <posChr>  <qualChr> <qualReads> <advChanges> 	n/a	n/a	n/a	<otherInfo>
U3   <snpId> <SNP type> <posGene> <posChr>  <qualChr> <qualReads> <advChanges>	n/a	n/a	n/a	<otherInfo>     
CS   <snpId> <SNP type> <posGene> <posChr>  <qualChr> <qualReads> <advChanges> <advCondonChanges> <advCondonChanges2> <phase>	<otherInfo>
CN   <snpId> <SNP type> <posGene> <posChr>  <qualChr> <qualReads> <advChanges> <advCondonChanges> <advCondonChanges2> <phase>	<otherInfo> <SIFTresult>
CF   <snpId> <SNP type> <posGene> <posChr>  <qualChr> <qualReads> <advChanges>	n/a	n/a	n/a	<otherInfo>
IR   <snpId> <SNP type> <posGene> <posChr>  <qualChr> <qualReads> <advChanges>	n/a	n/a	n/a	<otherInfo>
SS   <snpId> <SNP type> <posGene> <posChr>  <qualChr> <qualReads> <advChanges>  <ssChanges>	n/a	n/a	<otherInfo>

symbol		Description

GeneName   :	the name of gene
chrNum     :	chromosome number, location in chromosome 
txStart    :	Transcription start position in chromosome coordinate
txEnd      :	Transcription end position in chromosome coordinate
strand     :	+ or - for the strand, +: forward; -: reverse
identity   :    identity of gene location 
partM      :	"C" means the start codon and stop codon could be found in the genome.
		"P" means not.

snpId      :	a unique name asigned to each SNP
		snp.10.103.59910.S.1:  10.103 indicates Contig.10.103
				       59910  indicates the base position at Contigs.10.103
				       S indicates type of polymorphism.
				       1 strain name and version number,
					    1: Broiler strain
					    2: Layer strain, 
					    3: Silkie strain,
SNP type   :	SNP type, S: substitution; I: insertion; D: deletion
posGene    :	position of each SNP with gene coordinates
		posGene =0 in S5, S3, IR, SS.
posChr     :	position of each SNP with chromosome coordinates
qualChr    :	quality value of each SNP in chromosome
qualReads  :	quality value of each SNP in reads
advChanges :	"C->G" changes of the sequences, from the reference(contig) sequence to strain-specific(read) sequence
		if SNP type is insertion or deletion (Indels), then we will give the inserted/deleted sequence.
		indel sequence will be reversed when a gene is on the - strand.
		Note: treat genes as forward strand.
advCondonChanges:eg. "CCT->CGT" changes of the codon, from CCT to CGT. ( CCT in chr, CGT in reads)
           	for places where cdna and genome disagree by an indel, IGNORE these codons, 
		as we did in the rice snp analysis
advCondonChanges2:eg. "Phe->Ser" changes of the codon, means from TTT to TCT. ( TTT in chr, TCT in reads)
           	for places where cdna and genome disagree by an indel, IGNORE these codons, 
		as we did in the rice snp analysis
phase      :	phase of SNP position in the codon
ssChanges  :	changes at splice site. such as GT -> TT (or AG -> AT)
		SSIndel:indels in splice site.
otherInfo  :	fileds contains PCR primer sequences and all the other information from SNPtables.
		such as flanking sequences, read names, strand, occurStr, questionM, transposonM, etc.. 
		pay attention to flanking sequence, we display the reverse sequence when genes is on reverse strand.
		strand will be changed, too. here strand will indicate relationship between reads and genes.
		the description about these:
SIFTresult :	for each non-synonymous SNPs, we run SIFT to determine likelihood of being functional basesd on the
		degree of consvervation across species. The result was at last column. 
		for example, "[A102V  TOLERATED 0.27  3.00]".